Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5956

expand all nodes | collapse all nodes | view schema

Name Class

Expr5956Expression_of (2)
HomolHomol_homolF35G12:Expr
Expression_data (2)
TypeReporter_gene[sel-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAACTTTTTAGGCTGTTTGGG] 3' and primer B 5' [AAAGCCCTAGAGGGATGGC] 3'.
PatternAdult Expression: Reproductive System; vulval muscle;
RemarkStrain: BC10594
ReferenceWBPaper00006525
TransgeneWBTransgene00002325