Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5821

expand all nodes | collapse all nodes | view schema

Name Class

Expr5821Expression_of (2)
HomolHomol_homolF22B3:Expr
Expression_data (2)
TypeReporter_gene[his-64::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCAGCGAGGAAATAAAATTACA] 3' and primer B 5' [TCCACGTCCGGAGATTGT] 3'.
PatternLarval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; head neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Picture (2)
Remark (2)
ReferenceWBPaper00006525
TransgeneWBTransgene00002902