WormBase Tree Display for Expr_pattern: Expr5727
expand all nodes | collapse all nodes | view schema
Expr5727 | Expression_of | Gene | WBGene00006626 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006626 | ||
Homol | Homol_homol | F10G7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005788 | |||
WBbt:0005821 | |||
Type | Reporter_gene | [tsn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCGGGACGATCAGGT] 3' and primer B 5' [TCAGTGATTCTCTTTTGTTGCTTC] 3'. | |
Pattern | Adult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; vulval muscle; unidentified cells; | ||
Larval Expression: pharynx; pharyngeal gland cells; intestine; unidentified cells; | |||
Remark | Also expressed in (comments from author) : Uncertain whether seeing a hint of hypodermis or not.Embryo incomplete. To be updated.Strain not available. | ||
Strain: BC12354 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002300 |