Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5672

expand all nodes | collapse all nodes | view schema

Name Class

Expr5672Expression_ofGeneWBGene00004423
Reflects_endogenous_expression_ofWBGene00004423
HomolHomol_homolAH9:Expr
Expression_dataLife_stage (2)
Anatomy_term (12)
TypeReporter_gene[rpl-11.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTTTCAATTGCTTCCATCAATA] 3' and primer B 5' [TCACCGATGTCTGTAAAGAGGTAA] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; head neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; Nervous System; nerve ring; head neurons; unidentified cells in head; unidentified cells in tail ;
Picture (4)
RemarkStrain: BC15452
ReferenceWBPaper00006525
TransgeneWBTransgene00003974