WormBase Tree Display for Expr_pattern: Expr5025
expand all nodes | collapse all nodes | view schema
Expr5025 | Expression_of | Gene | WBGene00015062 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015062 | ||||
Homol | Homol_homol | B0228:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005772 | Partial | |||
Remark | anterior cells | ||||
Type | Reporter_gene | [B0228.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGACCATGATTTTGAGTCG] 3' and primer B 5' [TACCATATCAGCAAGCTCCAGA] 3'. | |||
Pattern (2) | |||||
Remark | Also expressed in (comments from author) : difficult to detect of embryo is expressing | ||||
Strain: BC13081 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004429 |