WormBase Tree Display for Feature: WBsf980905
expand all nodes | collapse all nodes | view schema
| WBsf980905 | SMap | S_parent | Sequence | ZK896 | |
|---|---|---|---|---|---|
| Name | Public_name | TTX-1 binding site | |||
| Sequence_details | Flanking_sequences | tactgacgtattttgagtagacacagtagt | cttaaatttaagcagctcaaatcagatttc | ||
| Mapping_target | ZK896 | ||||
| DNA_text | taat | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | Binding site for the TTX-1 transcription factor within the gcy-18 promoter region, core sequence for protein-DNA interaction, T-II | |||
| SO_term | SO:0000235 | ||||
| Defined_by | Defined_by_paper | WBPaper00046365 | |||
| Associations | Associated_with_gene | WBGene00001543 | Paper_evidence | WBPaper00046365 | |
| Associated_with_transcription_factor | WBTranscriptionFactor000216 | Paper_evidence | WBPaper00046365 | ||
| Bound_by_product_of | WBGene00006652 | Paper_evidence | WBPaper00046365 | ||
| Method | TF_binding_site |
