WormBase Tree Display for Feature: WBsf979085
expand all nodes | collapse all nodes | view schema
| WBsf979085 | SMap | S_parent | Sequence | C03C11 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | cttatttggacatattccaagaagaccggt | gtcggcatatttggcgctgaacttggaaac | |
| Mapping_target | C03C11 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | First intron of fog-3. | ||
| SO_term | SO:0001492 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00001483 | ||
| Associated_with_Interaction | WBInteraction000534268 | |||
| WBInteraction000534269 | ||||
| WBInteraction000534270 | ||||
| WBInteraction000534271 | ||||
| WBInteraction000534272 | ||||
| WBInteraction000534273 | ||||
| WBInteraction000534274 | ||||
| WBInteraction000534275 | ||||
| WBInteraction000534276 | ||||
| Remark | [150922 gw3] This is the first intron of fog-3 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00044244 | |
| Method | regulatory_region |
