WormBase Tree Display for Feature: WBsf979037
expand all nodes | collapse all nodes | view schema
| WBsf979037 | SMap | S_parent | Sequence | W02A2 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tggagttgcatgcgctatctgtgcttacgt | attgcctttgtcctctgcgactattctgtc | |
| Mapping_target | W02A2 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | First intron of fat-2. | ||
| SO_term | SO:0001492 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00001394 | ||
| Associated_with_Interaction (82) | ||||
| Remark | [150922 gw3] This is the first intron of fat-2 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00044244 | |
| Method | regulatory_region |
