WormBase Tree Display for Feature: WBsf978960
expand all nodes | collapse all nodes | view schema
WBsf978960 | SMap | S_parent | Sequence | F46C8 |
---|---|---|---|---|
Name | Public_name | UNC-86 binding motif | ||
Sequence_details | Flanking_sequences | aggacaccctctcttaattgcttttgacat | ttgaaatgtttctttcttttttcaaatttt | |
Mapping_target | F46C8 | |||
DNA_text | caattaag | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Binding site for UNC-86 transcription factor within the promoter region of ceh-14 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00046959 | ||
Associations | Associated_with_gene | WBGene00000438 | ||
Associated_with_Interaction | WBInteraction000532897 | |||
Associated_with_transcription_factor | WBTranscriptionFactor000094 | |||
Bound_by_product_of | WBGene00006818 | |||
Method | TF_binding_site |