WormBase Tree Display for Feature: WBsf978911
expand all nodes | collapse all nodes | view schema
| WBsf978911 | SMap | S_parent | Sequence | Y39E4B |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gaaattagtcgaatcgtttgccaccgcatc | gaaaggcggtgcgtcgtgcttgacgccagt | |
| Mapping_target | Y39E4B | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of Y39E4B.2. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00012715 | ||
| Associated_with_Interaction | WBInteraction000531825 | |||
| WBInteraction000531826 | ||||
| WBInteraction000531827 | ||||
| WBInteraction000531828 | ||||
| Remark | [150922 gw3] This is a region upstream of Y39E4B.2 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
