WormBase Tree Display for Feature: WBsf978875
expand all nodes | collapse all nodes | view schema
WBsf978875 | SMap | S_parent | Sequence | Y67A6A |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tgtgcctgtatatgttttgtagtcaaagct | ttctcaactctctcaccaagcgccattgac | |
Mapping_target | Y67A6A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Promoter region of Y67A6A.2. | ||
SO_term | SO:0000167 | |||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00003652 | ||
Associated_with_Interaction | WBInteraction000532433 | |||
WBInteraction000532434 | ||||
WBInteraction000532435 | ||||
WBInteraction000532436 | ||||
WBInteraction000532437 | ||||
Remark | [150922 gw3] This is a region upstream of Y67A6A.2 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
Method | promoter |