WormBase Tree Display for Feature: WBsf978620
expand all nodes | collapse all nodes | view schema
| WBsf978620 | SMap | S_parent | Sequence | ZK488 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gttttctatcagaaaatctgatgacaactg | ctagtgaaatctttacaaacttgcaaaatt | |
| Mapping_target | ZK488 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of ZK488.2. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00003680 | ||
| Associated_with_Interaction | WBInteraction000532706 | |||
| WBInteraction000532707 | ||||
| WBInteraction000532708 | ||||
| WBInteraction000532709 | ||||
| WBInteraction000532710 | ||||
| WBInteraction000532711 | ||||
| Remark | [150922 gw3] This is a region upstream of ZK488.2 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
