WormBase Tree Display for Feature: WBsf978559
expand all nodes | collapse all nodes | view schema
| WBsf978559 | SMap | S_parent | Sequence | Y48A5B |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | agagctcatgaatagcagtgccacatttta | acgtcgtcgaaggaggagatgccggatgag | |
| Mapping_target | Y48A5B | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of F52C12.5. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00001253 | ||
| Associated_with_Interaction | WBInteraction000530038 | |||
| WBInteraction000530039 | ||||
| WBInteraction000530040 | ||||
| WBInteraction000530041 | ||||
| WBInteraction000530042 | ||||
| Remark | [150922 gw3] This is a region upstream of F52C12.5 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
