WormBase Tree Display for Feature: WBsf978436
expand all nodes | collapse all nodes | view schema
| WBsf978436 | SMap | S_parent | Sequence | F44C8 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ttcccaccctgagatgtatgacacaactta | cctgctcctctattcttgtcggggccctgc | |
| Mapping_target | F44C8 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of F44C8.2. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00003724 | ||
| Associated_with_Interaction | WBInteraction000529862 | |||
| WBInteraction000529863 | ||||
| WBInteraction000529864 | ||||
| WBInteraction000529865 | ||||
| WBInteraction000529866 | ||||
| WBInteraction000529867 | ||||
| Remark | [150922 gw3] This is a region upstream of F44C8.2 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
