WormBase Tree Display for Feature: WBsf978319
expand all nodes | collapse all nodes | view schema
| WBsf978319 | SMap | S_parent | Sequence | CHROMOSOME_X |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gactctgactaaaccatctgtaatgtccgt | gcaaaagtgtcctcgccaaaaacatctggg | |
| Mapping_target | CHROMOSOME_X | |||
| Origin | Species | Caenorhabditis elegans | ||
| History | Acquires_merge | WBsf978320 | ||
| Visible | Description | Promoter region of C56E10.4. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00003727 | ||
| Associated_with_Interaction | WBInteraction000529137 | |||
| WBInteraction000529138 | ||||
| WBInteraction000529139 | ||||
| WBInteraction000529140 | ||||
| Remark | [150922 gw3] This is a region upstream of C56E10.4 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
