WormBase Tree Display for Feature: WBsf919592
expand all nodes | collapse all nodes | view schema
| WBsf919592 | SMap | S_parent | Sequence | R13A5 |
|---|---|---|---|---|
| Name | Public_name | TF LIN-1 binding site S11 in pJW5 | ||
| Sequence_details | Flanking_sequences | caaagtgtgcgggatttggactacggtactattttgcag | gctcttgttagcgctccaaacgctccaaacagttttg | |
| Mapping_target | R13A5 | |||
| DNA_text | AAACGGAAAGA | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | LIN-1 binding site affecting lin-39 expression. | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00027690 | ||
| Associations | Associated_with_gene | WBGene00003024 | ||
| Associated_with_Interaction | WBInteraction000521632 | |||
| Associated_with_transcription_factor | WBTranscriptionFactor000135 | |||
| Bound_by_product_of | WBGene00002990 | |||
| Remark | They tested binding of GST:LIN-1(1278) to 17 oligonucleotides containing 21 GGA sites (Supplemental Table 1). LIN-1 was able to bind to three of these oligonucleotides (Fig. 6C): S11, containing the sequence AAACGGAAAGA (7% of E74 control binding). [2013-07-23 gw3] | |||
| Method | TF_binding_site |
