WormBase Tree Display for Feature: WBsf919567
expand all nodes | collapse all nodes | view schema
| WBsf919567 | SMap | S_parent | Sequence | F44E5 |
|---|---|---|---|---|
| Name | Public_name | HSE | ||
| Sequence_details | Flanking_sequences | gatgcagctggtgcagtggaatattccagaagc | gatgttacgggaaaggtataaaagggctgggattc | |
| Mapping_target | F44E5 | |||
| DNA_text | TCCTAGAA | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is a conserved binding site region 'HSE' for the Hsp70 genes F44E5.5 and F44E5.4. | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00005280 | ||
| Associations | Associated_with_gene | WBGene00009692 | ||
| WBGene00009691 | ||||
| Associated_with_transcription_factor | WBTranscriptionFactor000178 | |||
| Bound_by_product_of | WBGene00002004 | |||
| Remark | This is a conserved binding site region 'HSE' for the Hsp70 genes F44E5.5 and F44E5.4. [2013-07-23 gw3] | |||
| Method | TF_binding_site |
