WormBase Tree Display for Feature: WBsf919552
expand all nodes | collapse all nodes | view schema
WBsf919552 | SMap | S_parent | Sequence | F23B12 |
---|---|---|---|---|
Name | Public_name | Snail binding site IV | ||
Sequence_details | Flanking_sequences | ttcatgatatttgatacgaacagagaatgactta | ggtgtggaggatttggtgacgtggatgagtttac | |
Mapping_target | F23B12 | |||
DNA_text | CAGCTG | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is the snail binding site 'IV' of Region 'B'. | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00006120 | ||
Associations | Associated_with_gene | WBGene00001170 | ||
Associated_with_Interaction | WBInteraction000524109 | |||
WBInteraction000524113 | ||||
Associated_with_transcription_factor | WBTranscriptionFactor000057 | |||
Bound_by_product_of | WBGene00000468 | |||
Remark | This site is bound by two competing TFs. [2013-07-23 gw3] | |||
Method | TF_binding_site |