WormBase Tree Display for Feature: WBsf919542
expand all nodes | collapse all nodes | view schema
| WBsf919542 | SMap | S_parent | Sequence | F38G1 |
|---|---|---|---|---|
| Name | Public_name | '322 to 117' enhancer | ||
| Sequence_details | Flanking_sequences | gtctcgatacaattgtccgacaacttcaagt | gttttacaggcatccatctttgatttccgactctaattt | |
| Mapping_target | F38G1 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | The '322 to 117' enhancer region of egl-17. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00005841 | ||
| Associations | Associated_with_gene | WBGene00001185 | ||
| Associated_with_Interaction | WBInteraction000521616 | |||
| Remark | The '322 to 117' enhancer region of egl-17 contains an additional regulatory element that controls egl-17 transcription at the early stages. [2013-07-23 gw3] | |||
| Method | enhancer |
