WormBase Tree Display for Feature: WBsf919541
expand all nodes | collapse all nodes | view schema
| WBsf919541 | SMap | S_parent | Sequence | F38G1 |
|---|---|---|---|---|
| Name | Public_name | 'vulDC' enhancer | ||
| Sequence_details | Flanking_sequences | ctagtttcccccctcatctcttatatcgtctgtcttta | aaagaaaaaagtgacaaaaaagttgattaaatt | |
| Mapping_target | F38G1 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | The 'vulDC' enhancer of egl-17. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00005841 | ||
| Associations | Associated_with_gene | WBGene00001185 | ||
| Associated_with_Interaction | WBInteraction000521615 | |||
| Associated_with_expression_pattern | Expr11283 | |||
| Associated_with_construct | WBCnstr00018734 | |||
| Remark | The 'vulDC' enhancer region activates reporter expression of egl-17 in vulD and vulC cells from mid-L4 through adulthood. [2013-07-23 gw3] | |||
| Method | enhancer |
