WormBase Tree Display for Feature: WBsf919531
expand all nodes | collapse all nodes | view schema
WBsf919531 | SMap | S_parent | Sequence | R13A5 |
---|---|---|---|---|
Name | Public_name | CEH-20 binding site | ||
Sequence_details | Flanking_sequences | cggaacagttggtaagttgccacaacccaaa | ttcggtggctcgacttcttccaaaatgcac | |
Mapping_target | R13A5 | |||
DNA_text | TGATGGATGG | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is a CEH-20 binding site | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00005094 | ||
Associations | Associated_with_gene | WBGene00000437 | ||
Associated_with_Interaction | WBInteraction000521666 | |||
Associated_with_transcription_factor | WBTranscriptionFactor000486 | |||
Bound_by_product_of | WBGene00000443 | |||
Remark | 10-bp-long DNA element whose sequence, TGATGGATGG, is identical to that of the HOXB1/PBX autoregulatory element of the mouse gene Hoxb1 and differs in only one position from that of the corresponding element in the midgut enhancer region of the Drosophila gene labial. [2013-07-23 gw3] | |||
Method | TF_binding_site |