WormBase Tree Display for Feature: WBsf919528
expand all nodes | collapse all nodes | view schema
| WBsf919528 | SMap | S_parent | Sequence | R13A5 |
|---|---|---|---|---|
| Name | Public_name | enh740 | ||
| Sequence_details | Flanking_sequences | ttcacaccattttctagatcccggattaact | gctttttccacaattccctaagatccagtaagac | |
| Mapping_target | R13A5 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | 740-bp enhancer (called 'enh740' in paper). | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00005094 | ||
| Associations | Associated_with_gene | WBGene00000437 | ||
| Associated_with_Interaction | WBInteraction000521668 | |||
| WBInteraction000524257 | ||||
| Associated_with_expression_pattern | Expr11276 | |||
| Associated_with_construct | WBCnstr00018730 | |||
| Remark | 740-bp enhancer (called 'enh740' in paper) located at the downstream end of enh3.4. enh740 drives early embryonic expression of a reporter gene in C. elegans in a pattern indistinguishable from ceh-13. [2013-07-23 gw3] | |||
| Method | enhancer |
