WormBase Tree Display for Feature: WBsf919527
expand all nodes | collapse all nodes | view schema
| WBsf919527 | SMap | S_parent | Sequence | R13A5 |
|---|---|---|---|---|
| Name | Public_name | enh450 | ||
| Sequence_details | Flanking_sequences | ctttctatcttttaaatgtcggtatgttcaa | ctcgaacgccttcttagcgccgatgaatttt | |
| Mapping_target | R13A5 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This enhancer (called 'enh450' in paper) is sufficient to drive ceh-13-like comma-stage expression of a reporter. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00005094 | ||
| Associations | Associated_with_gene | WBGene00000437 | ||
| Associated_with_Interaction | WBInteraction000521667 | |||
| Associated_with_expression_pattern | Expr11274 | |||
| Associated_with_construct | WBCnstr00018530 | |||
| Remark | Enhancer (called 'enh450' in paper) is sufficient to drive ceh-13-like comma-stage expression of a reporter, contains a 10-bp-long DNA element whose sequence, TGATGGATGG, is identical to that of the mouse Hoxb1 autoregulatory element. [2013-07-23 gw3] | |||
| Method | enhancer |
