WormBase Tree Display for Feature: WBsf919526
expand all nodes | collapse all nodes | view schema
WBsf919526 | SMap | S_parent | Sequence | R13A5 |
---|---|---|---|---|
Name | Public_name | enh3.4 | ||
Sequence_details | Flanking_sequences | ctttctatcttttaaatgtcggtatgttca | gctttttccacaattccctaagatccagtaagac | |
Mapping_target | R13A5 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00005094 | ||
Associations | Associated_with_gene | WBGene00000437 | ||
Associated_with_Interaction | WBInteraction000521669 | |||
Associated_with_expression_pattern | Expr11275 | |||
Associated_with_construct | WBCnstr00018729 | |||
Remark | 3.4-kb enhancer of ceh-13 (called 'enh3.4' in paper), located 3.26.6 kb upstream of the start site. [2013-07-23 gw3] | |||
Method | enhancer |