WormBase Tree Display for Feature: WBsf652447
expand all nodes | collapse all nodes | view schema
WBsf652447 | SMap | S_parent | Sequence | F48G7 |
---|---|---|---|---|
Name | Public_name | MCM_0000023252 | ||
Sequence_details | Flanking_sequences | tatttaagcacacccagtcttcaaggtttc | tcgaaaattgctttcaatcatcttcacttt | |
Mapping_target | F48G7 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 19 | |||
Associations | Associated_with_gene | WBGene00018616 | ||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |