WormBase Tree Display for Feature: WBsf189392
expand all nodes | collapse all nodes | view schema
WBsf189392 | SMap | S_parent | Sequence | Y59A8B |
---|---|---|---|---|
Sequence_details | Flanking_sequences | GCTAAAAAACTGAAAAATTTCAATTTTCAG | GAACTTCCGAGCGTATTTGTCTCGTCAAAG | |
Mapping_target | Y59A8B | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
Defined_by | Defined_by_sequence | Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_V_18075488_18075489_-_wb170 | ||
Defined_by_analysis | RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 1 | ||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 | 2 | |||
RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 | 1 | |||
RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092372 | 1 | |||
Remark | Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | |||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092372 with 1 reads | ||||
Method | SL1 |