WormBase Tree Display for Feature: WBsf132695
expand all nodes | collapse all nodes | view schema
| WBsf132695 | SMap | S_parent | Sequence | C48D1 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ccatcataaacttttttttccgcgaaattt | aaattgttacgcaatatatacaatccataa | |
| Mapping_target | C48D1 | |||
| DNA_text | gcaataaaccggccaaaaactttctcc | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | PAL-1 binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00029147 | ||
| Associations | Associated_with_gene | WBGene00000417 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000142 | |||
| Bound_by_product_of | WBGene00003912 | |||
| Remark | This promoter site contains the caudal consensus DNA binding site, TTTAT(G) | Paper_evidence | WBPaper00029147 | |
| The PAL-1 protein binds ced-3 promoter sequences in the tail-spike cell to promote cell death | Paper_evidence | WBPaper00029147 | ||
| Method | TF_binding_site |
