WormBase Tree Display for Feature: WBsf1026936
expand all nodes | collapse all nodes | view schema
| WBsf1026936 | SMap | S_parent | Sequence | Y54G2A |
|---|---|---|---|---|
| Name | Public_name | CR1 | ||
| Sequence_details | Flanking_sequences | gaacacaatctctcgaatacgtggcgttcc | ttttttgcatggagttccatgtaaaaacat | |
| Mapping_target | Y54G2A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is the conserved region 1 (CR1) which contains at least 2 putative GATA binding sites. | ||
| SO_term | SO:0005836 | |||
| Defined_by | Defined_by_paper | WBPaper00053295 | ||
| Associations | Associated_with_gene | WBGene00003008 | ||
| Associated_with_expression_pattern | Expr13577 | |||
| Remark | See Supporting information file pbio.2002429.s001.docx in the paper WBPaper00053295. [2018-04-27 gw3] | |||
| Method | regulatory_region |
