WormBase Tree Display for Feature: WBsf1026936
expand all nodes | collapse all nodes | view schema
WBsf1026936 | SMap | S_parent | Sequence | Y54G2A |
---|---|---|---|---|
Name | Public_name | CR1 | ||
Sequence_details | Flanking_sequences | gaacacaatctctcgaatacgtggcgttcc | ttttttgcatggagttccatgtaaaaacat | |
Mapping_target | Y54G2A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is the conserved region 1 (CR1) which contains at least 2 putative GATA binding sites. | ||
SO_term | SO:0005836 | |||
Defined_by | Defined_by_paper | WBPaper00053295 | ||
Associations (2) | ||||
Remark | See Supporting information file pbio.2002429.s001.docx in the paper WBPaper00053295. [2018-04-27 gw3] | |||
Method | regulatory_region |