WormBase Tree Display for Feature: WBsf047579
expand all nodes | collapse all nodes | view schema
| WBsf047579 | SMap | S_parent | Sequence | C32C4 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tcctactttattcattttgcaattgagcaaa | aggtgcctgatattttacggcttccgcccat | |
| Mapping_target | C32C4 | |||
| DNA_text | gcatctgc | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | putative E-box | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00032411 | ||
| Associations | Associated_with_gene | WBGene00003088 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000062 | |||
| Bound_by_product_of | WBGene00001948 | |||
| Remark | The ASE motif requires an additional regulatory motif to be active. | |||
| Method | TF_binding_site |
