WormBase Tree Display for Feature: WBsf047566
expand all nodes | collapse all nodes | view schema
| WBsf047566 | SMap | S_parent | Sequence | W03F8 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | agcagcaaccatttttaatataattttttct | caactccaatcccttccatttttttttccaa | |
| Mapping_target | W03F8 | |||
| DNA_text | AAGTG | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Possible transcription factor binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00025009 | ||
| Associations | Associated_with_gene | WBGene00006586 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000061 | |||
| Bound_by_product_of | WBGene00000445 | |||
| Remark | The CEH-22 binding site (AAGTG) was conserved in tni-4. It is suggested that CEH-22, together with a second unknown factor could control the pharyngeal expression of tni-4. | |||
| Method | TF_binding_site |
