WormBase Tree Display for Feature: WBsf042305
expand all nodes | collapse all nodes | view schema
WBsf042305 | SMap | S_parent | Sequence | F38G1 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ttgccgcagctctctgaattgctgccagctg | tgctcgcgcatggctcagctagtgtttgcaa | |
Mapping_target | F38G1 | |||
DNA_text | GTTGTCATGGTGAC | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | X-box | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00003977 | ||
Associations (2) | ||||
Bound_by_product_of | WBGene00000914 | |||
Remark | Transcription factor binding site, 130bp upstream of start codon, in the promoter | |||
Method | TF_binding_site |