WormBase Tree Display for Feature: WBsf041230
expand all nodes | collapse all nodes | view schema
| WBsf041230 | SMap | S_parent | Sequence | Y59A8B | |
|---|---|---|---|---|---|
| Name | Other_name | CL-2717_1 | |||
| Sequence_details | Flanking_sequences | TAAGAATGGAATAGTCACAATTCATTCAAC | GATTCCAAATGTCCCTACAGTTTCAGCAGT | ||
| Mapping_target | Y59A8B | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | Polymorphic segmental duplication as defined by the tool OrthoCluster. This feature represents one sequence from a pair of duplicons in the N2 genome. | |||
| SO_term | SO:1000038 | ||||
| Defined_by | Defined_by_paper | WBPaper00034747 | |||
| Defined_by_analysis | Vergara_OrthoCluster_duplication | ||||
| Associations | Associated_with_Feature | WBsf041231 | Paper_evidence | WBPaper00034747 | |
| Remark | [090904 pad] Annotated this feature based on published data. | Paper_evidence | WBPaper00034747 | ||
| Method | segmental_duplication |
