WormBase Tree Display for Feature: WBsf019551
expand all nodes | collapse all nodes | view schema
| WBsf019551 | SMap | S_parent | Sequence | Y58A7A | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ACAAAGAAAAATTACATTTTCAGCTTCCAG | CTCTCGTTTAAACTCAAAATATCGTCGTCA | ||
| Mapping_target | Y58A7A | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | SL1 trans-splice leader acceptor site | |||
| SO_term | SO:0000706 | ||||
| Defined_by | Defined_by_sequence | yk721g4.5 | Curator_confirmed | WBPerson1846 | |
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_sl1_V_5080710_5080711_-_wb170 | |||||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_V_5080709_5080710_-_wb170 | |||||
| lin-35_n745_mid-L1_25dC_4.0hrs_post-L1_bundle_of_reads_supporting_SL1_V_5080709_5080710_-_wb170 | |||||
| mid-L2_20dC_14hrs_post-L1_bundle_of_reads_supporting_SL1_V_5080709_5080710_-_wb170 | |||||
| Defined_by_analysis | RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 | 1 | |||
| RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 | 1 | ||||
| RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103988 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 | 1 | ||||
| Associations | Associated_with_CDS | Y58A7A.3 | |||
| Associated_with_transcript | Y58A7A.3.2 | ||||
| Remark | Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103988 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 with 1 reads | |||||
| Method | SL1 |
