WormBase Tree Display for Feature: WBsf019182
expand all nodes | collapse all nodes | view schema
WBsf019182 | SMap | S_parent | Sequence | C12C8 |
---|---|---|---|---|
Name | Public_name | LCS 6 | ||
Sequence_details | Flanking_sequences | aatatttgaaatctcaggaaaagtctaaag | ttttcctcaaattgcaccaactcaagtataccttttatacaaccgttcta | |
Mapping_target | C12C8 | |||
DNA_text | aattaaaacacccacaatagcacctc | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is the let-7 'LCS 6' binding site in the 3' UTR of lin-41. | ||
SO_term | SO:0000409 | |||
Defined_by | Defined_by_paper (2) | |||
Associations | Associated_with_gene | WBGene00003026 | ||
Bound_by_product_of | WBGene00002285 | |||
Remark | This is the miRNA let-7 complementary sequence 6 (LCS 6). [2014-09-02 gw3] | |||
Method | binding_site |