WormBase Tree Display for Feature: WBsf019100
expand all nodes | collapse all nodes | view schema
| WBsf019100 | SMap | S_parent | Sequence | F38G1 | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ttcaaaaacggccaacccccggtgcgactc | cactgtctcctcccccgtcaccctcctttt | ||
| Mapping_target | F38G1 | ||||
| DNA_text | TGATTAAT | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | Transcription factor binding site | |||
| SO_term | SO:0000235 | ||||
| Defined_by | Defined_by_paper | WBPaper00005841 | Person_evidence | WBPerson1983 | |
| Associations | Associated_with_gene | WBGene00001185 | |||
| Associated_with_Interaction | WBInteraction000521614 | ||||
| Associated_with_transcription_factor | WBTranscriptionFactor000095 | ||||
| Bound_by_product_of | WBGene00003024 | ||||
| WBGene00000443 | |||||
| Remark | EXD/HOX binding site identified from the Transfac database (Wingender et al., 2000) site of LIN-39/CEH-20 heterodimer binding. | ||||
| Method | TF_binding_site |
