WormBase Tree Display for Variation: WBVar02153765

WBVar02153765 Name: Public_name: gk5565
    HGVSg: CHROMOSOME_IV:g.8487420_8488298del
  Sequence_details: SMap: S_parent: Sequence: C28C12
    Flanking_sequences: TCTTTTCCGACATTACTAGTATACGAAGGATGAGAGAGTGAGAGAGAGTAGGTAT AGCATGAACGAGTCTTCTGATGTCAACGAC
    Mapping_target: CHROMOSOME_IV
    Type_of_mutation: Deletion
    SeqStatus: Pending_curation
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00047693
    Laboratory: VC
    Person: WBPerson427
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00016180
    Transcript: C28C12.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-708
        CDS_position: ?-672
        Protein_position: ?-224
        Intron_number: 2/3
        Exon_number: 1-3/4
  Isolation: Mutagen: CRISPR_Cas9
  Genetics: Interpolated_map_position: IV 3.84931
  Remark: Batch created from Strain genotype data Curator_confirmed: WBPerson1983
    Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced.
  Method: Deletion_allele