WormBase Tree Display for Variation: WBVar02151808

WBVar02151808 Name: Public_name: tm11476
    HGVSg: CHROMOSOME_X:g.2312099_2320706del
  Sequence_details: SMap: S_parent: Sequence: T01B6
    Flanking_sequences: tcaagcccggcctcaccccctagaatcatt tgttattgagcgtttttgttatcagggaga
    Mapping_target: T01B6
    Source_location: 7 CHROMOSOME_X 2312098 2320707 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11476_external
      tm11476_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11476
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00198015
      WBGene00197717
      WBGene00020135
      WBGene00002039
    Transcript: T01B6.3a.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 2-11/12
        Exon_number: 1-13/13
      T01B6.9 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      T10H10.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 23-27/28
        Exon_number: 24-29/29
      T01B6.3b.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 2/3
        Exon_number: 1-4/4
      T01B6.8 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Remark: [T10H10]34997/34998-[T01B6]11691/11692 (8608 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target T10H10 updated based on the VEP analysis pipeline to T01B6.
  Method: NBP_knockout_allele