WormBase Tree Display for Variation: WBVar02147421
expand all nodes | collapse all nodes | view schema
| WBVar02147421 | Evidence | Paper_evidence | WBPaper00046863 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | et27 | |||||||
| Other_name (11) | |||||||||
| HGVSg | CHROMOSOME_V:g.14196869T>C | ||||||||
| Sequence_details | SMap | S_parent | Sequence | ZC376 | |||||
| Flanking_sequences | atgttgatcttttctcttctggacctcttc | ttgtgttccgaaacaagaagacgttttcga | |||||||
| Mapping_target | ZC376 | ||||||||
| Type_of_mutation | Substitution | t | c | Paper_evidence | WBPaper00046863 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | QC | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00013878 | |||||||
| Transcript | ZC376.7d.1 (12) | ||||||||
| ZC376.7c.1 (12) | |||||||||
| ZC376.7a.2 (12) | |||||||||
| ZC376.7b.2 (12) | |||||||||
| ZC376.7a.1 (12) | |||||||||
| ZC376.7c.2 (12) | |||||||||
| ZC376.7b.1 (12) | |||||||||
| Interactor | WBInteraction000537440 | ||||||||
| Genetics | Interpolated_map_position | V | 6.1969 | ||||||
| Description | Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00046863 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | atfs-1(et27) did not affect expression of the hsp-60::GFP transgene (Figure 5B,5C) | Paper_evidence | WBPaper00046863 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00046863 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | hsp-60::GFP | Paper_evidence | WBPaper00046863 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000523 | Paper_evidence | WBPaper00046863 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Ten of these mutants were characterized in some detail. All were growth-inhibited by 0.5 mM fluvastatin, to which the atfs-1(et15) allele is resistant, and all harbored mutations within the coding region of atfs-1 (Figure 5, D and E)." | Paper_evidence | WBPaper00046863 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00046863 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00003950 | Paper_evidence | WBPaper00046863 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00046863 | ||||||||
| Method | Substitution_allele |
