WormBase Tree Display for Variation: WBVar02146649

WBVar02146649 Name: Public_name: tm7150
    Other_name: Y110A7A.14.1:c.343_*4del
    HGVSg: CHROMOSOME_I:g.5105243_5105703del
  Sequence_details: SMap: S_parent: Sequence: Y110A7A
    Flanking_sequences: tacagtcttgaaagattatttcaaaggcaa aagattctggacgagctgctcaactggcat
    Mapping_target: Y110A7A
    Source_location: 7 CHROMOSOME_I 5105242 5105704 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7150_external
      tm7150_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7150
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003924
    Transcript: Y110A7A.14.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y110A7A.14.1:c.343_*4del
        cDNA_position: 346-760
        CDS_position: 343-?
        Protein_position: 115-?
        Intron_number: 2/3
        Exon_number: 2-4/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 4607/4608-5068/5069 (461 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele