WormBase Tree Display for Variation: WBVar02146360
expand all nodes | collapse all nodes | view schema
| WBVar02146360 | Evidence | Paper_evidence | WBPaper00048724 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | qm150sea8 | |||||
| Other_name | F42G8.12.1:c.511C>T | ||||||
| CE17071:p.Arg171Cys | |||||||
| HGVSg | CHROMOSOME_IV:g.8135132G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F42G8 | |||
| Flanking_sequences | ccagaaggaaaaacaaagacattcgaatgg | gtggaaagccagtcttcgtcaaacatcgta | |||||
| Mapping_target | F42G8 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00048724 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | KAE | ||||||
| Status | Live | ||||||
| Linked_to | WBVar00241264 | ||||||
| Affects | Gene | WBGene00002162 | |||||
| Transcript | F42G8.12.1 (12) | ||||||
| Interactor | WBInteraction000536192 | ||||||
| Genetics | Interpolated_map_position | IV | 3.62255 | ||||
| Description | Phenotype | WBPhenotype:0000676 | Paper_evidence | WBPaper00048724 | |||
| Curator_confirmed | WBPerson3376 | ||||||
| Remark | The sea8 allele is an intragenic suppressor of the isp-1(qm150) slow development phenotype | Paper_evidence | WBPaper00048724 | ||||
| Curator_confirmed | WBPerson3376 | ||||||
| Reference | WBPaper00048724 | ||||||
| Remark | Intragenic suppressor of isp-1(qm150) | Paper_evidence | WBPaper00048724 | ||||
| Method | Substitution_allele |
