WormBase Tree Display for Variation: WBVar02146352

WBVar02146352 Evidence: Paper_evidence: WBPaper00003091
  Name: Public_name: n3073
    Other_name: C48B4.4c.1:c.3994A>T
      CE20575:p.Arg1386Ter
      CE24856:p.Arg1317Ter
      C48B4.4d.1:c.4156A>T
      CE24857:p.Arg1319Ter
      C48B4.4a.2:c.3949A>T
      CE27867:p.Arg1332Ter
      C48B4.4b.1:c.3955A>T
      C48B4.4a.1:c.3949A>T
    HGVSg: CHROMOSOME_III:g.9572396T>A
  Sequence_details: SMap: S_parent: Sequence: C48B4
    Flanking_sequences: gcacagtccaaacttgtgaaagaaatcttc aacaaacttgaattggagaagaacaaaaag
    Mapping_target: C48B4
    Type_of_mutation: Substitution: t a Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: MT
    Status: Live
  Affects: Gene: WBGene00000421
    Transcript: C48B4.4b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C48B4.4b.1:c.3955A>T
        HGVSp: CE24857:p.Arg1319Ter
        cDNA_position: 4097
        CDS_position: 3955
        Protein_position: 1319
        Exon_number: 14/17
        Codon_change: Aga/Tga
        Amino_acid_change: R/*
      C48B4.4d.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C48B4.4d.1:c.4156A>T
        HGVSp: CE20575:p.Arg1386Ter
        cDNA_position: 4156
        CDS_position: 4156
        Protein_position: 1386
        Exon_number: 13/15
        Codon_change: Aga/Tga
        Amino_acid_change: R/*
      C48B4.4c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C48B4.4c.1:c.3994A>T
        HGVSp: CE27867:p.Arg1332Ter
        cDNA_position: 3994
        CDS_position: 3994
        Protein_position: 1332
        Exon_number: 12/14
        Codon_change: Aga/Tga
        Amino_acid_change: R/*
      C48B4.4a.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C48B4.4a.2:c.3949A>T
        HGVSp: CE24856:p.Arg1317Ter
        cDNA_position: 4117
        CDS_position: 3949
        Protein_position: 1317
        Exon_number: 14/17
        Codon_change: Aga/Tga
        Amino_acid_change: R/*
      C48B4.4a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C48B4.4a.1:c.3949A>T
        HGVSp: CE24856:p.Arg1317Ter
        cDNA_position: 4099
        CDS_position: 3949
        Protein_position: 1317
        Exon_number: 14/17
        Codon_change: Aga/Tga
        Amino_acid_change: R/*
  Genetics: Interpolated_map_position: III 0.643283
  Reference: WBPaper00003091
  Remark: Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
  Method: Substitution_allele