WormBase Tree Display for Variation: WBVar02145038
expand all nodes | collapse all nodes | view schema
| WBVar02145038 | Name | Public_name | tm7868 | |||||
|---|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_X:g.11729194_11739115del | |||||||
| Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | ||||
| Flanking_sequences | gacctgaatcagtcgaaacgcaagagaggt | ggactcagcattgaagccgccaatgtggat | ||||||
| Mapping_target | CHROMOSOME_X | |||||||
| Source_location | 7 | CHROMOSOME_X | 11729193 | 11739116 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Deletion | |||||||
| PCR_product | tm7868_external | |||||||
| tm7868_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 7868 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00008368 | ||||||
| WBGene00043187 | ||||||||
| Transcript | D1053.3.1 | VEP_consequence | transcript_ablation | |||||
| VEP_impact | HIGH | |||||||
| Intron_number | 2-7/8 | |||||||
| Exon_number | 1-9/9 | |||||||
| C40H5.1.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
| VEP_impact | MODIFIER | |||||||
| cDNA_position | ?-66 | |||||||
| CDS_position | ?-66 | |||||||
| Protein_position | ?-22 | |||||||
| Exon_number | 1/1 | |||||||
| D1053.3.2 | VEP_consequence | transcript_ablation | ||||||
| VEP_impact | HIGH | |||||||
| Intron_number | 1-8/9 | |||||||
| Exon_number | 1-10/10 | |||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | X | ||||||
| Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | [D1053]10942/10943-CAACTGGCATWGGGCTWGGGAWG-[C40H5]3653/3654 (9922 bp deletion + 23 bp insertion), 3818/3819-18049/18050 (14231 bp deletion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Old Mapping_target D1053 updated based on the VEP analysis pipeline to CHROMOSOME_X. | ||||||||
| Method | NBP_knockout_allele |
