WormBase Tree Display for Variation: WBVar02143987

WBVar02143987 Name: Public_name: tm7125
    Other_name: CE06357:p.Ala69GlyfsTer8
      T04F3.2.1:c.206_527del
    HGVSg: CHROMOSOME_V:g.11757922_11758289del
  Sequence_details: SMap: S_parent: Sequence: T04F3
    Flanking_sequences: aagcattaaaaagaaaaactgacggagatg gaagtttaatcaactcaatataaatcataa
    Mapping_target: T04F3
    Source_location: 7 CHROMOSOME_V 11757921 11758290 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7125_external
      tm7125_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (20)
    Laboratory: FX
      LW
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7125
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011437
    Transcript: T04F3.2.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00066003
  Remark: 8876/8877-9244/9245 (368 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele