WormBase Tree Display for Variation: WBVar02124803
expand all nodes | collapse all nodes | view schema
| WBVar02124803 | Name | Public_name | WBVar02124803 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | cewivar00855726 | |||||||
| Sequence_details | SMap | S_parent | Sequence | Y57G11C | ||||
| Flanking_sequences | TCATTTTTTTGCTTTGATGCTCAAATCTAA | GTGAAATATGAATATTTGTCGTATTGCTTG | ||||||
| Mapping_target | Y57G11C | |||||||
| Source_location | 225 | CHROMOSOME_IV | 14835001 | 14851000 | From_analysis | Million_mutation_project_reanalysis | ||
| Type_of_mutation | Tandem_duplication | |||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Natural_variant | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00027648 | From_analysis | Million_mutation_project_reanalysis | |||||
| Laboratory | VC | |||||||
| Analysis | Million_mutation_project_reanalysis | |||||||
| Status | Live | |||||||
| Affects | Gene (37) | |||||||
| Transcript (35) | ||||||||
| Pseudogene | Y57G11C.18 | |||||||
| Y57G11C.21 | ||||||||
| Remark | The boundaries of this variant have been identified only approximately | |||||||
| This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
| Method | WGS_Flibotte |
