WormBase Tree Display for Sequence: Y57G11C
expand all nodes | collapse all nodes | view schema
| Y57G11C | DNA | Y57G11C | 313577 | ||
|---|---|---|---|---|---|
| SMap | S_child (13) | ||||
| Structure | From | Source | CHROMOSOME_IV | ||
| Overlap_right | Y41E3 | 313474 | |||
| Overlap_left | F13G11 | ||||
| Clone_left_end | Y41E3 | 254313 | |||
| F52D11 | 286319 | ||||
| Y57G11C | 1 | ||||
| Clone_right_end | Y57G11 | 313577 | |||
| Y57G11C | 313577 | ||||
| DB_info | Database | EMBL | NDB_AC | Z99281 | |
| NDB_SV | Z99281.2 | ||||
| Secondary_accession | Z92841 | ||||
| DB_remark | [121025] Sequence correction WBsf268004 : Insertion T1 bases from @ 3719 | ||||
| [121025] Sequence correction WBsf267879 : Insertion A1 bases from @ 25363 | |||||
| [121025] Sequence correction WBsf268620 : Insertion G1 bases from @ 33287 | |||||
| [121025] Sequence correction WBsf267837 : Insertion T1 bases from @ 70130 | |||||
| Keyword | HTG | ||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
| Origin | From_author | McMurray AA | |||
| From_laboratory | HX | ||||
| Date_directory | 970721 | ||||
| Species | Caenorhabditis elegans | ||||
| Strain | WBStrain00000001 | ||||
| Visible | Clone | Y57G11C | |||
| Remark | 970901:sjj:frameshift detected at around 292500. Sequence data has been inspected and looks OK. | ||||
| [010822 kj] Removed erroneous clone left end tag for F13G11 | |||||
| Properties | Genomic_canonical | ||||
| Checksum | MD5 | 9f37c9e14313994ec290186c4ec30fbb | |||
| Status | Finished | 21 Jul 1997 00:00:00 | |||
| Submitted | 17 Sep 1997 00:00:00 | ||||
| Annotated | 12 Sep 1997 00:00:00 | ||||
| Map | Sequence-IV | Ends | Left | 7521 | |
| Right | 7609 | ||||
| Interpolated_map_position | IV | 12.4907 | |||
| Assembly_tags | Clone left end | 104 | 101 | F13G11 | |
| 254313 | 254318 | Y41E3 | |||
| 286319 | 286322 | F52D11 | |||
| Finished Left | 1 | 4 | Y57G11C | ||
| annotation | 142134 | 142363 | tandem repeat across bases 308461 - 309522 with typical repeat element ACCCTTGTGATCCTTTGGAGCTGAAGATTCAGTTCATAAGGGGG (49mer). Size confirmed by restriction digest. | ||
| 142364 | 142737 | tandem repeat across bases 308461 - 309522 with typical repeat element ACCCTTGTGATCCTTTGGAGCTGAAGATTCAGTTCATAAGGGGG (49mer). Size confirmed by restriction digest. | |||
| 142738 | 143006 | tandem repeat across bases 308461 - 309522 with typical repeat element ACCCTTGTGATCCTTTGGAGCTGAAGATTCAGTTCATAAGGGGG (49mer). Size confirmed by restriction digest. | |||
| 143007 | 143195 | tandem repeat across bases 308461 - 309522 with typical repeat element ACCCTTGTGATCCTTTGGAGCTGAAGATTCAGTTCATAAGGGGG (49mer). Size confirmed by restriction dig | |||
| 143634 | 143635 | GT missing from one template but confirmed by others | |||
| 143655 | 143671 | bases 309982 - 309998 are covered by a single clone | |||
| 144600 | 146000 | [140520 gw3] We appear to have a pair of genes sharing the same transcript here. It doesn't look like a typical operon - no TSL features. | |||
| 160200 | 159200 | [140520 gw3] Interesting possible RNA edited transcript. This is a conserved locus with a frameshift in that has lots of mass-spec and polysome evidence of translation. | |||
| Finished Right | 313572 | 313577 | Y57G11C | ||
| Clone right end | 313572 | 313577 | Y57G11 | ||
| Method | Genomic_canonical |
