WormBase Tree Display for Variation: WBVar02124639
expand all nodes | collapse all nodes | view schema
WBVar02124639 | Name | Public_name | WBVar02124639 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855562 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | ||||
Flanking_sequences | TCCGAAAATGACAATTTCCGGCAAATCGTA | ATTTTGCCGGAATTTAAAATTTCCGGCAAA | ||||||
Mapping_target | Y59A8B | |||||||
Source_location | 225 | CHROMOSOME_V | 18043006 | 18043111 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027660 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |