WormBase Tree Display for Variation: WBVar02123973
expand all nodes | collapse all nodes | view schema
WBVar02123973 | Name | Public_name | WBVar02123973 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854896 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y53C12B | ||||
Flanking_sequences | TCTGAATATCCGTCAAGGGAGTCGACGAAA | AACTATAGAGATCCGATGAGCTTGAAAATT | ||||||
Mapping_target | Y53C12B | |||||||
Source_location | 225 | CHROMOSOME_II | 9730001 | 9743000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022930 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00013143 | ||||||
WBGene00198696 | ||||||||
WBGene00013144 | ||||||||
WBGene00003100 | ||||||||
Transcript | Y53C12B.5b.1 | |||||||
Y53C12B.9 | ||||||||
Y53C12B.5b.2 | ||||||||
Y53C12B.1.1 | ||||||||
Y53C12B.5a.1 | ||||||||
Y53C12B.2.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |