WormBase Tree Display for Variation: WBVar02123940
expand all nodes | collapse all nodes | view schema
WBVar02123940 | Name | Public_name | WBVar02123940 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854863 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | ||||
Flanking_sequences | AATAAATATTTTTTGCAGATGCTAAAACAATTTCCAAGTAAAAAAATCATGTATTCAGTGGGCAAGCAGCGGTGAAAGTGGTCAATGCAATATGATGGAT | TCTGCATCAACCGTAGCAGCGGCTGCTGCT | ||||||
Mapping_target | Y59A8B | |||||||
Source_location | 225 | CHROMOSOME_V | 18044001 | 18058000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022902 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00305846 | ||||||
WBGene00305847 | ||||||||
WBGene00013344 | ||||||||
WBGene00305845 | ||||||||
Transcript | Y59A8B.45 | |||||||
Y59A8B.7.1 | ||||||||
Y59A8B.44 | ||||||||
Y59A8B.46 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |