WormBase Tree Display for Variation: WBVar02123891
expand all nodes | collapse all nodes | view schema
WBVar02123891 | Name | Public_name | WBVar02123891 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854814 | |||||||
Sequence_details | SMap | S_parent | Sequence | C05D12 | ||||
Flanking_sequences | TGAGCAGATTTCTAGGATTTTATTAGGCAC | TTGATTCTACTCTTTGCTCCATTATTGTTT | ||||||
Mapping_target | C05D12 | |||||||
Source_location | 225 | CHROMOSOME_II | 11414001 | 11434000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022902 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00007339 | ||||||
WBGene00007341 | ||||||||
WBGene00014666 | ||||||||
WBGene00007340 | ||||||||
Transcript | C05D12.4.1 | |||||||
C05D12.1.2 | ||||||||
C05D12.3c.1 | ||||||||
C05D12.3c.3 | ||||||||
C05D12.3c.2 | ||||||||
C05D12.2.1 | ||||||||
C05D12.3a.1 | ||||||||
C05D12.1.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |